ID: 1102950567_1102950574

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1102950567 1102950574
Species Human (GRCh38) Human (GRCh38)
Location 12:117028139-117028161 12:117028167-117028189
Sequence CCTCGCACTGGCCTTTCCCTATA GTTTAGGGATGTGCCTCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 142} {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!