ID: 1102950571_1102950579

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1102950571 1102950579
Species Human (GRCh38) Human (GRCh38)
Location 12:117028155-117028177 12:117028186-117028208
Sequence CCCTATAACCATGTTTAGGGATG TTGGGAGCAAGGAGAAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 92} {0: 1, 1: 0, 2: 4, 3: 40, 4: 509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!