ID: 1103050383_1103050390

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1103050383 1103050390
Species Human (GRCh38) Human (GRCh38)
Location 12:117774374-117774396 12:117774416-117774438
Sequence CCTCATTAATGAGCTTGGCATTC TTGGGCACTAGCCCCGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 181} {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!