ID: 1103120175_1103120181

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1103120175 1103120181
Species Human (GRCh38) Human (GRCh38)
Location 12:118373194-118373216 12:118373234-118373256
Sequence CCTACGGGCCCGCCTGGGGTGCG TGCTCTCCGGTCAAAGTTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 90} {0: 1, 1: 0, 2: 1, 3: 4, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!