ID: 1103320005_1103320018

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1103320005 1103320018
Species Human (GRCh38) Human (GRCh38)
Location 12:120086970-120086992 12:120087021-120087043
Sequence CCGGCGCTGCGCCGCGGCTGTAG ACGTTAGTCAGCACATTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 57} {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!