ID: 1103350131_1103350145

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1103350131 1103350145
Species Human (GRCh38) Human (GRCh38)
Location 12:120278240-120278262 12:120278286-120278308
Sequence CCAGGCAGAGGTGCTCCCCACCT GACGCCCCTCACCTCCCAGACGG
Strand - +
Off-target summary {0: 33, 1: 258, 2: 1614, 3: 11674, 4: 9599} {0: 44, 1: 1461, 2: 5129, 3: 5108, 4: 4286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!