ID: 1103393203_1103393211

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1103393203 1103393211
Species Human (GRCh38) Human (GRCh38)
Location 12:120589094-120589116 12:120589118-120589140
Sequence CCGGAGCCAAGGCAAGGCTGTGG GGGCGGGCGGCCTCCCAGTTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 25, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!