ID: 1103447074_1103447078

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1103447074 1103447078
Species Human (GRCh38) Human (GRCh38)
Location 12:121001426-121001448 12:121001447-121001469
Sequence CCTGTTCATGGCAGATGTAGGAG AGGGACTGTCGCTGCTTCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 105} {0: 1, 1: 0, 2: 0, 3: 3, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!