ID: 1103478185_1103478193

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1103478185 1103478193
Species Human (GRCh38) Human (GRCh38)
Location 12:121233573-121233595 12:121233587-121233609
Sequence CCACAGCCCCATCAAAGAACAGA AAGAACAGAGAGGAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 303} {0: 1, 1: 1, 2: 42, 3: 399, 4: 2528}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!