ID: 1103764641_1103764656

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1103764641 1103764656
Species Human (GRCh38) Human (GRCh38)
Location 12:123271597-123271619 12:123271630-123271652
Sequence CCAAGTTCGGTTTGTAAGACATC GCGGGCGCGCCGGGCGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 39} {0: 1, 1: 7, 2: 20, 3: 154, 4: 865}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!