ID: 1103766505_1103766516 |
View in Genome Browser |
Spacer: -5 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1103766505 | 1103766516 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 12:123283967-123283989 | 12:123283985-123284007 |
Sequence | CCACCCACCTTGCCCTCCCACAG | CACAGTGCTGGGATTACAGGCGG |
Strand | - | + |
Off-target summary | No data | {0: 19, 1: 1668, 2: 1844, 3: 1351, 4: 1631} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |