ID: 1103766505_1103766516

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1103766505 1103766516
Species Human (GRCh38) Human (GRCh38)
Location 12:123283967-123283989 12:123283985-123284007
Sequence CCACCCACCTTGCCCTCCCACAG CACAGTGCTGGGATTACAGGCGG
Strand - +
Off-target summary {0: 1, 1: 367, 2: 24134, 3: 77844, 4: 159030} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!