ID: 1103877270_1103877273

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1103877270 1103877273
Species Human (GRCh38) Human (GRCh38)
Location 12:124137941-124137963 12:124137973-124137995
Sequence CCTTCTTACCTAAAGAACTAGAT TGTTTATTCAGATCTACTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 148} {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!