ID: 1103921072_1103921082

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1103921072 1103921082
Species Human (GRCh38) Human (GRCh38)
Location 12:124399430-124399452 12:124399468-124399490
Sequence CCTTTCACCCTGGGCCTCCAAGT GGCAGCTGGAAAATATCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 340} {0: 1, 1: 0, 2: 1, 3: 12, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!