ID: 1103926604_1103926608

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1103926604 1103926608
Species Human (GRCh38) Human (GRCh38)
Location 12:124426865-124426887 12:124426887-124426909
Sequence CCCAGGGAAGACACAGAGGGGAC CGGATGGTCTGCGCCAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 454} {0: 1, 1: 0, 2: 0, 3: 1, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!