ID: 1103981186_1103981192

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1103981186 1103981192
Species Human (GRCh38) Human (GRCh38)
Location 12:124738032-124738054 12:124738061-124738083
Sequence CCTCAGTTTCCCCATCTGTACAA CAGTAACACCTCAAAGATCATGG
Strand - +
Off-target summary {0: 16, 1: 350, 2: 2422, 3: 7760, 4: 15337} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!