|
Left Crispr |
Right Crispr |
| Crispr ID |
1104021699 |
1104021709 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:124996413-124996435
|
12:124996464-124996486
|
| Sequence |
CCTGCCTCAGCCTCCTGAGTAGC |
CAAGTGAGCACCACCACATCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 77881, 1: 176222, 2: 210480, 3: 146546, 4: 90715} |
{0: 2, 1: 28, 2: 478, 3: 3815, 4: 15197} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|