ID: 1104021705_1104021709

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1104021705 1104021709
Species Human (GRCh38) Human (GRCh38)
Location 12:124996435-124996457 12:124996464-124996486
Sequence CCGGGATTACAAGTGAGTAGCCG CAAGTGAGCACCACCACATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44} {0: 2, 1: 28, 2: 478, 3: 3815, 4: 15197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!