|
Left Crispr |
Right Crispr |
Crispr ID |
1104021708 |
1104021713 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:124996455-124996477
|
12:124996484-124996506
|
Sequence |
CCGGGATTACAAGTGAGCACCAC |
CGGCTAATTTTTTATGTTTTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 14, 2: 117, 3: 647, 4: 2911} |
{0: 8, 1: 149, 2: 1108, 3: 2590, 4: 2807} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|