ID: 1104203537_1104203549

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1104203537 1104203549
Species Human (GRCh38) Human (GRCh38)
Location 12:126615057-126615079 12:126615098-126615120
Sequence CCCATTGAGAACATATCTCCCAA CCCCGCGATGAGCAAGGCGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!