ID: 1104252177_1104252183

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1104252177 1104252183
Species Human (GRCh38) Human (GRCh38)
Location 12:127105477-127105499 12:127105515-127105537
Sequence CCTCACTGCAGCCTTGATTTCCC TCCCACCTCAGCTTCCCGAGTGG
Strand - +
Off-target summary No data {0: 7, 1: 189, 2: 1087, 3: 3081, 4: 6175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!