ID: 1104351195_1104351197

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1104351195 1104351197
Species Human (GRCh38) Human (GRCh38)
Location 12:128045411-128045433 12:128045440-128045462
Sequence CCAATATCTATGTCTGCAGCTCG CAGGCTGCTGTTTGTTAGAAAGG
Strand - +
Off-target summary No data {0: 6, 1: 33, 2: 39, 3: 93, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!