ID: 1104351195_1104351198

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1104351195 1104351198
Species Human (GRCh38) Human (GRCh38)
Location 12:128045411-128045433 12:128045452-128045474
Sequence CCAATATCTATGTCTGCAGCTCG TGTTAGAAAGGAAAATAACTTGG
Strand - +
Off-target summary No data {0: 1, 1: 23, 2: 53, 3: 185, 4: 814}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!