ID: 1104440190_1104440198

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1104440190 1104440198
Species Human (GRCh38) Human (GRCh38)
Location 12:128787899-128787921 12:128787946-128787968
Sequence CCCCACATGAATCCAGTGTGGCC AAAGACACTTTGTCCAAATGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!