ID: 1104584819_1104584824 |
View in Genome Browser |
Spacer: 16 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1104584819 | 1104584824 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 12:130039517-130039539 | 12:130039556-130039578 |
Sequence | CCGGATACTGGATAATTTATAAA | GACTCACAGTTCCCCAGGGCTGG |
Strand | - | + |
Off-target summary | No data | {0: 5, 1: 251, 2: 3897, 3: 9101, 4: 8936} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |