ID: 1104584819_1104584824

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1104584819 1104584824
Species Human (GRCh38) Human (GRCh38)
Location 12:130039517-130039539 12:130039556-130039578
Sequence CCGGATACTGGATAATTTATAAA GACTCACAGTTCCCCAGGGCTGG
Strand - +
Off-target summary No data {0: 5, 1: 251, 2: 3897, 3: 9101, 4: 8936}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!