ID: 1104587925_1104587938

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1104587925 1104587938
Species Human (GRCh38) Human (GRCh38)
Location 12:130062511-130062533 12:130062563-130062585
Sequence CCCCTGCTCTGTGCAGCCTTGGG GCTCCCGTCTTGGCTAAAAGGGG
Strand - +
Off-target summary {0: 52, 1: 149, 2: 469, 3: 1161, 4: 1675} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!