ID: 1104587927_1104587938

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1104587927 1104587938
Species Human (GRCh38) Human (GRCh38)
Location 12:130062512-130062534 12:130062563-130062585
Sequence CCCTGCTCTGTGCAGCCTTGGGA GCTCCCGTCTTGGCTAAAAGGGG
Strand - +
Off-target summary {0: 31, 1: 125, 2: 617, 3: 827, 4: 1005} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!