ID: 1104702596_1104702603

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1104702596 1104702603
Species Human (GRCh38) Human (GRCh38)
Location 12:130918491-130918513 12:130918505-130918527
Sequence CCCTCCCTGACCCGCGTTGCACT CGTTGCACTCGTCAGGAACGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!