ID: 1104894466_1104894477

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1104894466 1104894477
Species Human (GRCh38) Human (GRCh38)
Location 12:132155035-132155057 12:132155062-132155084
Sequence CCCGTCCCCCGATTCCGGGTCTC CAGGAAATGAACGCGGCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 249} {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!