ID: 1105295961_1105295964

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1105295961 1105295964
Species Human (GRCh38) Human (GRCh38)
Location 13:19088131-19088153 13:19088145-19088167
Sequence CCTGGCTGCATATGTGTAGACAG TGTAGACAGCCAAAGCTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 107} {0: 1, 1: 0, 2: 1, 3: 13, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!