ID: 1105323261_1105323267

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1105323261 1105323267
Species Human (GRCh38) Human (GRCh38)
Location 13:19347219-19347241 13:19347268-19347290
Sequence CCCTCCCCACCAAGTGCGCGCAC ACACTCTTATTCTGCCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 106} {0: 1, 1: 0, 2: 3, 3: 114, 4: 1793}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!