ID: 1105543886_1105543890

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1105543886 1105543890
Species Human (GRCh38) Human (GRCh38)
Location 13:21337969-21337991 13:21338006-21338028
Sequence CCCAGAGAAGTTAAGTGACTTGT CTGTGTAAGTAGAAGTATGAAGG
Strand - +
Off-target summary {0: 2, 1: 33, 2: 210, 3: 754, 4: 1992} {0: 2, 1: 0, 2: 0, 3: 12, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!