ID: 1105567124_1105567130

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1105567124 1105567130
Species Human (GRCh38) Human (GRCh38)
Location 13:21560675-21560697 13:21560701-21560723
Sequence CCTACCCCATTGGGATTATTGCA ACACTGAATTTATAGATTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105} {0: 1, 1: 0, 2: 2, 3: 24, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!