ID: 1105607654_1105607662

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1105607654 1105607662
Species Human (GRCh38) Human (GRCh38)
Location 13:21940114-21940136 13:21940127-21940149
Sequence CCAGGCCTTCCAATCAGCCTTGG TCAGCCTTGGGGATACAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 191} {0: 1, 1: 0, 2: 0, 3: 21, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!