ID: 1105607654_1105607666

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1105607654 1105607666
Species Human (GRCh38) Human (GRCh38)
Location 13:21940114-21940136 13:21940138-21940160
Sequence CCAGGCCTTCCAATCAGCCTTGG GATACAGAGGGGGCATGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 191} {0: 1, 1: 0, 2: 3, 3: 27, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!