ID: 1105607659_1105607668

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1105607659 1105607668
Species Human (GRCh38) Human (GRCh38)
Location 13:21940123-21940145 13:21940150-21940172
Sequence CCAATCAGCCTTGGGGATACAGA GCATGGAGTGGCTGCTCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 108} {0: 1, 1: 0, 2: 0, 3: 42, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!