ID: 1105745983_1105745987

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1105745983 1105745987
Species Human (GRCh38) Human (GRCh38)
Location 13:23377293-23377315 13:23377333-23377355
Sequence CCTGAAAAAAATTCACAATGTAG GCTTTTCCTGGACCACCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 484} {0: 1, 1: 0, 2: 2, 3: 16, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!