ID: 1105855674_1105855675

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1105855674 1105855675
Species Human (GRCh38) Human (GRCh38)
Location 13:24370004-24370026 13:24370017-24370039
Sequence CCAATTGGTGTTGACTATTGCAT ACTATTGCATAGCCGTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 121} {0: 1, 1: 0, 2: 1, 3: 2, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!