ID: 1105920898_1105920901

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1105920898 1105920901
Species Human (GRCh38) Human (GRCh38)
Location 13:24962496-24962518 13:24962512-24962534
Sequence CCATCATGGTGGCTCCCGCCTGT CGCCTGTAATCCCAGCACTTCGG
Strand - +
Off-target summary {0: 4, 1: 8, 2: 296, 3: 1606, 4: 4464} {0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!