ID: 1105920898_1105920906

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1105920898 1105920906
Species Human (GRCh38) Human (GRCh38)
Location 13:24962496-24962518 13:24962522-24962544
Sequence CCATCATGGTGGCTCCCGCCTGT CCCAGCACTTCGGGAGGCCGAGG
Strand - +
Off-target summary {0: 4, 1: 8, 2: 296, 3: 1606, 4: 4464} {0: 1851, 1: 120775, 2: 266467, 3: 220261, 4: 244205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!