|
Left Crispr |
Right Crispr |
| Crispr ID |
1105920898 |
1105920909 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:24962496-24962518
|
13:24962526-24962548
|
| Sequence |
CCATCATGGTGGCTCCCGCCTGT |
GCACTTCGGGAGGCCGAGGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 8, 2: 296, 3: 1606, 4: 4464} |
{0: 598, 1: 39993, 2: 188867, 3: 270649, 4: 197220} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|