ID: 1105920898_1105920910

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1105920898 1105920910
Species Human (GRCh38) Human (GRCh38)
Location 13:24962496-24962518 13:24962538-24962560
Sequence CCATCATGGTGGCTCCCGCCTGT GCCGAGGTGGGCAGATCACCTGG
Strand - +
Off-target summary {0: 4, 1: 8, 2: 296, 3: 1606, 4: 4464} {0: 81, 1: 3954, 2: 19186, 3: 49295, 4: 62756}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!