|
Left Crispr |
Right Crispr |
| Crispr ID |
1105920899 |
1105920908 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:24962510-24962532
|
13:24962525-24962547
|
| Sequence |
CCCGCCTGTAATCCCAGCACTTC |
AGCACTTCGGGAGGCCGAGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 56, 1: 1866, 2: 2819, 3: 3149, 4: 3647} |
{0: 1410, 1: 92511, 2: 186343, 3: 138236, 4: 81632} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|