ID: 1105920899_1105920909

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1105920899 1105920909
Species Human (GRCh38) Human (GRCh38)
Location 13:24962510-24962532 13:24962526-24962548
Sequence CCCGCCTGTAATCCCAGCACTTC GCACTTCGGGAGGCCGAGGTGGG
Strand - +
Off-target summary {0: 56, 1: 1866, 2: 2819, 3: 3149, 4: 3647} {0: 598, 1: 39993, 2: 188867, 3: 270649, 4: 197220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!