|
Left Crispr |
Right Crispr |
| Crispr ID |
1105939939 |
1105939943 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:25138856-25138878
|
13:25138877-25138899
|
| Sequence |
CCACCACCACACTGGGCCAATCT |
CTCTGTGTTTTTAGTAGAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 2, 2: 80, 3: 1184, 4: 16019} |
{0: 1, 1: 190, 2: 12563, 3: 210854, 4: 144958} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|