ID: 1106087847_1106087859

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1106087847 1106087859
Species Human (GRCh38) Human (GRCh38)
Location 13:26558469-26558491 13:26558509-26558531
Sequence CCGCGCGCACGGAGCCGCGGCGC GGGGTCTTTACCCGCGCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138} {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!