ID: 1106157215_1106157223

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1106157215 1106157223
Species Human (GRCh38) Human (GRCh38)
Location 13:27170940-27170962 13:27170955-27170977
Sequence CCTTCACACACGCCCCTTTCCCC CTTTCCCCCAGCGCGGGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 410} {0: 1, 1: 0, 2: 1, 3: 4, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!