ID: 1106242082_1106242086

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1106242082 1106242086
Species Human (GRCh38) Human (GRCh38)
Location 13:27920512-27920534 13:27920532-27920554
Sequence CCAAAGCTCACGCGTGGAAAGGC GGCCAGTGGGCAGGTAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56} {0: 1, 1: 0, 2: 4, 3: 17, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!