ID: 1106336667_1106336679

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1106336667 1106336679
Species Human (GRCh38) Human (GRCh38)
Location 13:28789462-28789484 13:28789509-28789531
Sequence CCACCCTGCTTCTGCTTGCCCTC CAGTCCCAATGAGATGAACTGGG
Strand - +
Off-target summary No data {0: 120, 1: 697, 2: 1037, 3: 772, 4: 892}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!