|
Left Crispr |
Right Crispr |
| Crispr ID |
1106336667 |
1106336679 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:28789462-28789484
|
13:28789509-28789531
|
| Sequence |
CCACCCTGCTTCTGCTTGCCCTC |
CAGTCCCAATGAGATGAACTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 67, 1: 274, 2: 555, 3: 796, 4: 1307} |
{0: 120, 1: 697, 2: 1037, 3: 772, 4: 892} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|