ID: 1106439890_1106439898

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1106439890 1106439898
Species Human (GRCh38) Human (GRCh38)
Location 13:29757020-29757042 13:29757064-29757086
Sequence CCCTGGTCCACCTGTTCTCTCTC CCATGAGTAAAAGCTCCTTGAGG
Strand - +
Off-target summary No data {0: 23, 1: 297, 2: 670, 3: 838, 4: 1482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!