ID: 1107002043_1107002045

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1107002043 1107002045
Species Human (GRCh38) Human (GRCh38)
Location 13:35559284-35559306 13:35559322-35559344
Sequence CCTAAAATAAAGGGTGCTCTAAA CAGTATCACTTTAACGAACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 222} {0: 1, 1: 0, 2: 0, 3: 1, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!